Micro 982: Dr. Hideyoshi

[Isis]

Highlighted Rules

If you've played mafia a lot and only want to read half the rules, these are my priority

1. You must play to win the game. This is a sitewide rule.
   
2. "Pretending to break a rule is the same as breaking a rule" is included in Common Rules below, but it is particularly important with this rule. It's allowed to claim you are not fighting to win quite as hard as you did last game, but you cannot claim not to be playing to your win at all, even as a tactic that you believe gets you closer to your win condition. Tactics that nominally "hurt" your side are allowed if the goal is to win
   and
   any town hypotheticals you are presenting is that you are a townie, trying to win.
   
3. Avoid discussion of conditions that would cause you to concede or replace out, therefore. Both of those are only immediately messaged to a moderator (and I reserve the right to commute some concessions to forcereplacements).
   
4. If you feel totally unable to play to your win condition due to personal conflicts with other players, please request replacement upon realizing this.
   
5. This game is using a special rule that relates to hammer testing and quickhammer coordinations. When you make a vote, (this includes special votes, modify as appropriate), you can post,
   in bold
   ,
   I and all members of my faction that are known to me and I to them, VOTE: Isis and win the game
   . Do not name any other members of your faction. If you've made a mistake and voting together with all partners would not win you the game, it will be treated simply as a vote. If you haven't made a mistake, then you will perform votes on behalf of your teammates and win the game. It also fails if it hasn't been mechanically confirmed to you that it would be a win (so, usually scum).
   
6. Whenever the deadline closes on any town-controlled day decision, unless otherwise specified, the mafia are privately contacted to choose among the town's legal choices instead. *
   I use this a lot, but this game, Dr. Hideyoshi, will be plurality vote. Most votes wins, and on a tie, the option that reached that strength earliest breaks the tie.
   
7. Discuss site/game rule violations with the moderator/listmod by PM, not in the game thread.

Common Rules

1. All site-wide rules apply. In particular:
   No discussion of ongoing games is allowed
   . Post as though they don't exist, except when mentioning information whitelisted by the site rule: the number of games in which you are alive.
   
2. Do not quote your Role PM or any other PMs from the Mod, real or fabricated.
   
3. Do not quote private topics. Paraphrase. Do not mention timestamps on posts made in private topics. Remember that true paraphrasing focuses on the message being conveyed and not the linguistic or physical features of the messages - for instance, if Isis used a bulleted list, and that post strikes you as important and makes you think she feels confident she's solved this game, "Isis posted a bulleted list" is a physical feature you shouldn't reference, "Isis has been professory in the private topic" conveys the idea.
   
4. You may quote a private topic if it is fully known(everyone alive reading the post is also permitted to view the post in the private topic it came from.)
   
5. Do not edit or delete your post, even if you have the ability to do so.
   
6. Do not use encrypted text, small text, or otherwise make it hard to see what you are writing.
   
7. Do not use cryptography or other complex information hiding. If you hide information in a post, it must be based purely on the English letters in that post, without shifting them to different letters based on any kind of rule, and their significance must be left-to-right.
   
8. Do not use shared reminiscence convey information in a way only a subset of the readers will understand.
   
9. Do not discuss this game outside this thread or PTs related to this game you have access to, or PMs to me or another listmod.
   
10. Do not use provable randomness. Saying you used a random criteria is fine, providing even weak evidence that you did so isn't.
    
11. Do not fake mod posts/edits.
    
12. Once you are voted out, or venged, you may not post. No bah posts.
    
13. Be civil to other players. Criticize play, not players. As a rule of thumb, negative nouns or profane adjectives that describe a player will start strikes against you; describing actions of a player will not.
    
14. No set of rules can be complete. If you think something is wrong, please don't do it. Breaking the spirit of rules is also disallowed. Do not encourage others to break the rules either. If in doubt, please PM me.
    
15. During the course of the game I may add extra rules if necessary. These rule changes will be announced publicly.

Deadlines, Activity, and replacements

1. Day start. Days will last 7 real life days for day 1 and six real life days for each day thereafter.
   
2. Nights will last 48 hours. Similar mafia controlled decisions last 48 hours. Vengekills will last 48 hours.
   
3. Prods will be issued if you do not post for 48 hours.
   
4. If you get three or more prods, or fail to respond to a prod by posting in thread within 24 hours (or by PM if at Night), I will begin seeking for a replacement (this means the third prod functions like a notice that you are racing the search for your replacement.)
   
5. If you receive a prod and satisfy that prod, you are "on probation" for the next 96 hours after responding to that prod. Meeting criteria for a prod during probation immediately triggers the search for your replacement even if it's your second prod.
   
6. If you expect to be unable to post for a while, please declare V/LA in thread. Should your V/LA be unreasonably long (>5 days), however, I strongly suggest you request replacement. There's no probation during V/LA
   
7. You will still be prodded while on V/LA, but these will not count towards the above three prod limit. An official prod will be sent 24 hours after your V/LA ends if you haven't posted then.
   
8. When replacements or prods happen at night, deadlines will be tolled as appropriate to conceal information. If it is possible to conceal information and avoid tolling by forcing the active part of a faction to make decision on behalf of the entire faction, though, the deadline will not be tolled
   
9. For replacements, day deadlines are extended by the length of time between the moment the missing player owed a post to the thread per the prod rule and the first post of the new player. A post that does little more than acknowledge they've replaced into the game isn't counted as that post. Don't exploit this rule.
   
10. If you would like to replace out, please PM me. Do not publicly replace out, discuss about wanting to replace out, threaten to replace out, or persuade/dissuade others from replacing out.
    
11. Once your replacement request is publicized, it is final. You must cease to post. Inquiries about possibly retaining the slot must be conducted by mod PM.

Voting Rules

1. Use VOTE: tags to vote. Use UNVOTE: to unvote. You can overwrite your vote.
   
2. Abbreviations or misspellings in votes will be accepted as long as it is clear who you are voting for. Abbreviations will fail if they aren't unique to the playerlist.
   
3. A strict majority (more than half) of players is required demote a scientist to Freshman Biology Instruction.
   
4. Once majority is achieved, it is final, and the Day will end immediately with further votes and unvotes being invalid.
   
5. I will do my best to ensure that each vote count is accurate. Check the vote counts. If I make a grave error I may reset all votes at my discretion.

[Isis]

Dr. Hideyoshi's clone

Dr. Hideyoshi has been a respectable leader in the genetics lab for years, but something has gone wrong.

1

Mafia Clone of Dr. Hideyoshi

1

Mafia Clone Scientist

1

Town Dr. Hideyoshi

3

Town Scientist

From the start of the game, the mod reveals which players look like Dr. Hideyoshi.
There is only night zero. During Night zero, the mafia chooses a town player to be

Adrenaline-Tweaked

, and a Town Scientist to be

Creator of Dr. Hideyoshi's Clone

. They must be different. Those town players are not informed.

• If someone who looks like Dr. Hideyoshi is the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  becomes remorseful and eliminates themselves.
  
• If the Mafia Clone Scientist is the very first elimination, the most seditious scientist doesn't get to do enough whispering, and everyone realizes having two Dr. Hideyoshis can just be a chill thing actually and town wins.
  
• If a Town Scientist is the very first elimination, the
  Adrenaline-Tweaked
  player gains Day 2 Vengeful. However, if the
  Adrenaline-Tweaked
  player is themselves the player who was the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  gains Day 2 Vengeful instead. The player is not informed that they have gained Vengeful.

The game uses a parity win condition (checked after venges resolve).

[Isis]

Sample Role PM

Hectic, you are a

Town Scientist

.
This is an open setup, so I will not telling you what this means.
Please confirm your rolename and acknowledge that the mafia has daytalk.

[Isis]

1. hellbooks
   
2. The Bulge
   
3. PookyTheMagicalBear
   
4. Gloria Cleary
   
5. shellyc
   
6. TheGoldenParadox

[Isis]

In playerlist order:

PookyTheMagicalBear looks like Dr. Hideyoshi!
shellyc looks like Dr. Hideyoshi!

[Isis]

It is now night zero. The mafia are selecting a player to be Adrenaline Tweaked and a player to be the Creator of Dr. Hideyoshi's clone.

[Isis]

The lab assistant, Isis, takes a colorful disc, with "Rampage 4k" etched in sharpie on it, to the computer in the lab that could play it, having found it in the staff's rideshare this morning

"I don't think that's actually a thing. That series limped into this millennium and didn't make it far."

Instead of having a game, the screen displayed tons of data from a genome. Including the misplaced CCAGTCAGTCAGGGAGTGAGGGACCGAGGACCTGACCAGAGAGTTAGAGAGCCCCTGAGACCGAGATTTTGAGGACGAGAGATACATA sequence that gave Dr. Hideyoshi a life-altering cognitive state that brought the doctor to the place that doctor had come today.

"The audacity."

The mafia have selected a town player to become Dr. Hideyoshi's Clone's Creator.

[Isis]

"Who's turn is it to buy K cups?" Isis asked, sipping the last bit of her coffee.
"You shouldn't buy any, you addicts, you haven't run out," the angry technician Hectic snapped. "The nasty bitterness soils my tea enough as it is."
"Yes, we have run out. There's no more."
"No, when I finished with with the Keurig, there was a six pack of donut shop medium coffee, and a six pack of pumpkin spice flavoured coffee cups. There's only seven of you."
"Hectic I threw that pumpkin garbage out on sight, that swill is an abomination.. but how'd we just drink seven cups?"

The mafia have selected a town player to become Adrenaline-Tweaked.

[Isis]

Votecount 1.0

hellbooks -
The Bulge -

PookyTheMagicalBear

-
Gloria Cleary -

shellyc

-
TheGoldenParadox -

Not Voting (6) - hellbooks, The Bulge, PookyTheMagicalBear, Gloria Cleary, shellyc, TheGoldenParadox

Day 1 will end in (expired on 2020-11-19 05:00:00)

[The Bulge]

VOTE: teeeeegeeeeepeeeee

[shellyc]

I and all members of my faction that are known to me and I to them, VOTE: The Bulge and win the game.

[PookyTheMagicalBear]

shelly is conf scum

VOTE: ShellyC

[PookyTheMagicalBear]

Shelly if you tell me who your scumpartner is we can live happily ever after together

[The Bulge]

that's a bold opener from shelly (heh)

[PookyTheMagicalBear]

You can run the lab and I will chill and drink booze

[shellyc]

pooky you are confscum and the only reason im not voting you is because the town clone dying actually doesn't put us in such a good position tbh

[shellyc]

pooky you are confscum and the only reason im not voting you is because the town clone dying actually doesn't put us in such a good position tbh

*deep breath* town creator of dr. hideyoshi clone

[PookyTheMagicalBear]

just give up your partner shelly we can be good together

[shellyc]

btw i didnt realise that pooky was confscum before since i completely misread the setup and it confused me a lot

[shellyc]

pooky you got lucky with a mislaunchable target, but I'll try

[PookyTheMagicalBear]

you don't need to try just tell me who the traitor in the lab is

[Gloria Cleary]

Dr. Hideyoshi's clone

Dr. Hideyoshi has been a respectable leader in the genetics lab for years, but something has gone wrong.

1

Mafia Clone of Dr. Hideyoshi

1

Mafia Clone Scientist

1

Town Dr. Hideyoshi

3

Town Scientist

From the start of the game, the mod reveals which players look like Dr. Hideyoshi.
There is only night zero. During Night zero, the mafia chooses a town player to be

Adrenaline-Tweaked

, and a Town Scientist to be

Creator of Dr. Hideyoshi's Clone

. They must be different. Those town players are not informed.

• If someone who looks like Dr. Hideyoshi is the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  becomes remorseful and eliminates themselves.
  
• If the Mafia Clone Scientist is the very first elimination, the most seditious scientist doesn't get to do enough whispering, and everyone realizes having two Dr. Hideyoshis can just be a chill thing actually and town wins.
  
• If a Town Scientist is the very first elimination, the
  Adrenaline-Tweaked
  player gains Day 2 Vengeful. However, if the
  Adrenaline-Tweaked
  player is themselves the player who was the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  gains Day 2 Vengeful instead. The player is not informed that they have gained Vengeful.

The game uses a parity win condition (checked after venges resolve).

So if I understand this if either Shellley of Pooky get elimed on D1, the town scuentist dies but we can still win if neither die?

[Gloria Cleary]

Dr. Hideyoshi's clone

Dr. Hideyoshi has been a respectable leader in the genetics lab for years, but something has gone wrong.

1

Mafia Clone of Dr. Hideyoshi

1

Mafia Clone Scientist

1

Town Dr. Hideyoshi

3

Town Scientist

From the start of the game, the mod reveals which players look like Dr. Hideyoshi.
There is only night zero. During Night zero, the mafia chooses a town player to be

Adrenaline-Tweaked

, and a Town Scientist to be

Creator of Dr. Hideyoshi's Clone

. They must be different. Those town players are not informed.

• If someone who looks like Dr. Hideyoshi is the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  becomes remorseful and eliminates themselves.
  
• If the Mafia Clone Scientist is the very first elimination, the most seditious scientist doesn't get to do enough whispering, and everyone realizes having two Dr. Hideyoshis can just be a chill thing actually and town wins.
  
• If a Town Scientist is the very first elimination, the
  Adrenaline-Tweaked
  player gains Day 2 Vengeful. However, if the
  Adrenaline-Tweaked
  player is themselves the player who was the very first elimination, the
  Creator of Dr. Hideyoshi's Clone
  gains Day 2 Vengeful instead. The player is not informed that they have gained Vengeful.

The game uses a parity win condition (checked after venges resolve).

So if I understand this if either Shellley of Pooky get elimed on D1, the town scuentist dies but we can still win if neither die?

And the one of them who flips town, I mean, so we probably shouldn’t risk killing the town scientist.

[Gloria Cleary]

This is early and weak but very slight tl on Bulge.

[hellbooks]

VOTE: gloria cleary
hi