What's in your clipboard? (Ctrl+v)

[shaft.ed]

nothing apparently

[shaft.ed]

[redacted email address]@lrz.tu-muenchen.de

[shaft.ed]

461676916504

[shaft.ed]

same email address as last time. But I've restarted my computer...hmmm

[shaft.ed]

In the US, drug patents give twenty years of protection, but they are applied for before clinical trials begin, so the effective life of a drug patent tends to be between seven and twelve years.

[shaft.ed]

Code: Select all

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaaggaattcgaggagttggccgaagctgtggccctgctctcccagcgggggcctgacgccctgctcactgtggcacttcgaaagcccccaggtcagcgcacggatgaagagctggacctcatctttgaggagctgctgcacatcaaggctgtggcccacctctccaactcggtgaagcgagaattagcggctgttctgctctttgaaccacacagcaaggcagggaccgtgttgttcagccagggggacaagggcacttcgtggtacattatctggaagggatctgtcaacgtggtgacccatggcaaggggctggtgaccaccctgcatgagggagatgattttggacagctggctctggtgaatgatgcaccccgggcagccaccatcatcctgcgagaagacaactgtcatttcctgcgtgtggacaagcaggacttcaaccgtatcatcaaggatgtggaggcaaagaccatgcggctggaagaatctagaatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[shaft.ed]

Viel Spaß damit

[shaft.ed]

Progenitor Cell Conditioned Medium Promotes Neurite Outgrowth

[shaft.ed]

1. Kuhn B ,
2. Fromherz P ,
3. Denk W

[shaft.ed]

sig wrote:
Vi wrote:
Empking wrote:
Are you talking about horizantal size or vertical? It the same horizantally in Firefox too.
Vertical.
My one-line quote seems to be exactly as tall as shaft.ed's two-line sig quote, and the font size difference is pretty difficult to miss.

MafSepia>Subsilver
libel
^beautiful

[shaft.ed]

http://www.nytimes.com/interactive/2011 ... eral#/0_51

[shaft.ed]

oIMR9296 - CGC TGA ACT TGT GGC CGT TTA CG - Transgene Reverse

[shaft.ed]

i told me i might have to get a ph.d degree

[shaft.ed]

Loss of myelin in the central nervous system (CNS) leads to debilitating neurological deficits. High-resolution optical imaging of myelin in the CNS of animal models is limited by a lack of in vivo myelin labeling strategies. We demonstrated that third harmonic generation (THG) microscopy—a coherent, nonlinear, dye-free imaging modality—provides micrometer resolution imaging of myelin in the mouse CNS. In fixed tissue, we found that THG signals arose from white matter tracts and were colocalized with two-photon excited fluorescence (2PEF) from a myelin-specific dye. In vivo, we used simultaneous THG and 2PEF imaging of the mouse spinal cord to resolve myelin sheaths surrounding individual fluorescently-labeled axons, and followed myelin disruption after spinal cord injury. Finally, we suggest optical mechanisms that underlie the myelin specificity of THG. These results establish THG microscopy as an ideal tool for the study of myelin loss and recovery.

[shaft.ed]

Through process mapping, I performed economic analysis for a potential new facility. I interacted with colleagues in different departments and different levels within the organizations and reached many milestones together.

[shaft.ed]

The blood–brain barrier (BBB) and the environment of the central nervous system (CNS) guard the nervous tissue from peripheral immune cells. In the autoimmune disease multiple sclerosis, myelin-reactive T-cell blasts are thought to transgress the BBB1, 2 and create a pro-inflammatory environment in the CNS, thereby making possible a second autoimmune attack that starts from the leptomeningeal vessels and progresses into the parenchyma3, 4, 5, 6. Using a Lewis rat model of experimental autoimmune encephalomyelitis, we show here that contrary to the expectations of this concept, T-cell blasts do not efficiently enter the CNS and are not required to prepare the BBB for immune-cell recruitment. Instead, intravenously transferred T-cell blasts gain the capacity to enter the CNS after residing transiently within the lung tissues. Inside the lung tissues, they move along and within the airways to bronchus-associated lymphoid tissues and lung-draining mediastinal lymph nodes before they enter the blood circulation from where they reach the CNS. Effector T cells transferred directly into the airways showed a similar migratory pattern and retained their full pathogenicity. On their way the T cells fundamentally reprogrammed their gene-expression profile, characterized by downregulation of their activation program and upregulation of cellular locomotion molecules together with chemokine and adhesion receptors. The adhesion receptors include ninjurin 1, which participates in T-cell intravascular crawling on cerebral blood vessels. We detected that the lung constitutes a niche not only for activated T cells but also for resting myelin-reactive memory T cells. After local stimulation in the lung, these cells strongly proliferate and, after assuming migratory properties, enter the CNS and induce paralytic disease. The lung could therefore contribute to the activation of potentially autoaggressive T cells and their transition to a migratory mode as a prerequisite to entering their target tissues and inducing autoimmune disease.

[shaft.ed]

http://www.ncbi.nlm.nih.gov/pubmed/22392631

[shaft.ed]

http://www.ncbi.nlm.nih.gov/pubmed/23077034

[shaft.ed]

http://products.narishige-group.com/gro ... glish.html

[shaft.ed]

http://www.amazon.com/Carbon-Wok-Handle ... 0&sr=1-106

[shaft.ed]

http://rack.3.mshcdn.com/media/ZgkyMDE0 ... 3b8/22.jpg